Sequence ID | >WENV170652661 |
Genome ID | JRYH01012035 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1984 |
End posion on genome | 1900 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgcgtcccgt |
tRNA gene sequence |
GCCGGGATGGCGGAATCGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGTGTGTG |
Downstream region at tRNA end position |
gcagttggtc |
Secondary structure (Cloverleaf model) | >WENV170652661 Leu CAA t ACCA gcagttggtc G - C C - G C - G G - C G - C G - C A - T T G T C A C C C A T A A G | | | | | G C G G C G G T G G G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |