Sequence ID | >WENV170652726 |
Genome ID | JRYH01019170 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 74 |
End posion on genome | 1 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgcgcggcat |
tRNA gene sequence |
GCGGGCGTTGTGTAATGGTAAGACCTCAGCCTTCCAAGCTGATGATACGGGTTCGATTCC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652726 Gly TCC t TCCA nnnnnnnnnn G - C C - G G - C G - C G - C C - G G - C T T T T G C C C A A A T | | | | | G T T G T G A C G G G C G | | | T T G A G A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |