Sequence ID | >WENV170652824 |
Genome ID | JRYH01037747 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 382 |
End posion on genome | 456 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cgcatccagc |
tRNA gene sequence |
GGGCGGCTAGCTCAGTGGTAGAGCACTGCCTTCACACGGCAGGGGTCACAGGTTCGAACC |
Downstream region at tRNA end position |
gacattccaa |
Secondary structure (Cloverleaf model) | >WENV170652824 Val CAC c ACCA gacattccaa G - C G - C G - C C - G G - C G - C C - G C A T T G T C C A G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC C - G T - A G - C C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |