Sequence ID | >WENV170652841 |
Genome ID | JRYH01044333 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 199 |
End posion on genome | 126 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccgaaaatag |
tRNA gene sequence |
GGCATCGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTTTTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aattcttttc |
Secondary structure (Cloverleaf model) | >WENV170652841 Cys GCA g TCTA aattcttttc G - C G - C C - G A - T T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A TTAC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |