Sequence ID | >WENV170652918 |
Genome ID | JRYH01101665 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 347 |
End posion on genome | 271 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgcagcggct |
tRNA gene sequence |
CGGGGAGTAGCGCAGCCCGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttttcaattt |
Secondary structure (Cloverleaf model) | >WENV170652918 Pro TGG t ACCA ttttcaattt C - G G - C G - C G - C G - C A - T G - C T A T T G T C C A C G A A + | | | | G C C G C G G C A G G C C | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |