Sequence ID | >WENV170652990 |
Genome ID | JRYI01000335 |
Search identical group | |
Phylum/Class | [JRYI] activated sludge metagenome; activated biomass in a lab-scale reactor treating industrial wastewater at 1 ppm DO |
Species | |
Start position on genome | 28387 |
End posion on genome | 28313 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atagtttcgT |
tRNA gene sequence |
GCCCTTGTAGCTCAATGGTTAGAGCAGCGGACTCATAATCCGTTGGCTGTAGGTTCGAAT |
Downstream region at tRNA end position |
caatttttga |
Secondary structure (Cloverleaf model) | >WENV170652990 Met CAT T ATgc caatttttga G - C C - G C - G C - G T - A T + G G - C T A T C A T C C A T A A A | | | | | G G C T C G G T A G G C G | | | | T T T G A G C T A A TGGCT G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |