Sequence ID | >WENV170653887 |
Genome ID | JRYK01000142 |
Search identical group | |
Phylum/Class | [JRYK] activated sludge metagenome; activated biomass of a wastewaster treatment plant treating hydrocarbon contaminated |
Species | |
Start position on genome | 75565 |
End posion on genome | 75641 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttgcggctct |
tRNA gene sequence |
GGTCCCATAGCTCAGCCGGTTAGAGCATCTGACTCATAATCAGAGGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
taacagaatt |
Secondary structure (Cloverleaf model) | >WENV170653887 Met CAT t ACCA taacagaatt G - C G - C T - A C - G C - G C - G A - T C G T G A A C C A C G A A | | | | | G C C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |