| Sequence ID | >WENV170654028 |
| Genome ID | JRYK01003488 |
| Phylum/Class | [JRYK] activated sludge metagenome; activated biomass of a wastewaster treatment plant treating hydrocarbon contaminated |
| Species | |
| Start position on genome | 4366 |
| End posion on genome | 4443 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
tccccattca |
| tRNA gene sequence |
GGGAGCTTAGCTCAGCTGGTTCAGAGCACCTGCCTTACAAGCAGGGGGTCACTGGTTCGA |
| Downstream region at tRNA end position |
aagccaccga |
| Secondary structure (Cloverleaf model) | >WENV170654028 Val TAC
a ACAA aagccaccga
G - C
G - C
G - C
A - T
G - C
C - G
T - A C T
T T G A C C A
T C G A A | | | | | G
G C T C G A C T G G C
G | | | | T T
T G A G C
T C A A GGGTC
C - G
C - G
T - A
G - C
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |