Sequence ID | >WENV170655353 |
Genome ID | JTFN01024180 |
Search identical group | |
Phylum/Class | [JTFN] activated sludge metagenome; CETP activated sludge from CETP activated sludge from augmented bioreactor treating |
Species | |
Start position on genome | 129 |
End posion on genome | 205 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agagatttgt |
tRNA gene sequence |
CGGTGAATAGCGCAGTTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttatattgag |
Secondary structure (Cloverleaf model) | >WENV170655353 Pro TGG t ACCA ttatattgag C - G G - C G - C T - A G - C A - T A - T T A T C T C C C A T G A A | + | | | G T C G C G G G G G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |