Sequence ID | >WENV170655863 |
Genome ID | JTFN01087732 |
Search identical group | |
Phylum/Class | [JTFN] activated sludge metagenome; CETP activated sludge from CETP activated sludge from augmented bioreactor treating |
Species | |
Start position on genome | 468 |
End posion on genome | 393 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttcaaggtat |
tRNA gene sequence |
AGGGGTATAGCTCAATTGGCAGAGCGTCGGTCTCCAAAACCGAAGGTTGAGGGTTCGATT |
Downstream region at tRNA end position |
cccagtcact |
Secondary structure (Cloverleaf model) | >WENV170655863 Trp CCA t GCCA cccagtcact A - T G - C G - C G - C G - C T + G A - T T T T C T T C C A T A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C C A G AGGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |