| Sequence ID | >WENV170656055 |
| Genome ID | JTFN01121455 |
| Phylum/Class | [JTFN] activated sludge metagenome; CETP activated sludge from CETP activated sludge from augmented bioreactor treating |
| Species | |
| Start position on genome | 96 |
| End posion on genome | 22 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
gttttattac |
| tRNA gene sequence |
AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCATTCCCTGGTTCGAATC |
| Downstream region at tRNA end position |
tttacaatga |
| Secondary structure (Cloverleaf model) | >WENV170656055 Gln TTG
c GCCA tttacaatga
A - T
G - C
G - C
T - A
C - G
T - A
A - T T A
T G G A C C A
G A C | | | | | G
C A C C G C C T G G C
G | | | T T
G A G G C
T A A CATTC
G - C
C - G
G - C
G - C
C - G
T T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |