| Sequence ID | >WENV170657901 |
| Genome ID | JTFP01031557 |
| Phylum/Class | [JTFP] activated sludge metagenome; sludge from laboratory unaugmented bioreactor treating industrial wastewater |
| Species | |
| Start position on genome | 727 |
| End posion on genome | 803 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tttaaaatat |
| tRNA gene sequence |
CGCGGAATAGAGCAGTTCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAGGTTCAAA |
| Downstream region at tRNA end position |
atcaaatcat |
| Secondary structure (Cloverleaf model) | >WENV170657901 Met CAT
t ACCA atcaaatcat
C A
G - C
C - G
G - C
G - C
A - T
A - T T A
T T G T C C A
T G A A | | | | | A
T C G A G A C A G G C
C | | | | T T
G G C T C
G T A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |