Sequence ID | >WENV170658931 |
Genome ID | JUGB01000514 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 2053 |
End posion on genome | 2129 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ctcccacggt |
tRNA gene sequence |
CGGAGTGTGGCTCAGCCTGGTAGAGCACTGCGTTCGGGACGCAGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tcttctcttc |
Secondary structure (Cloverleaf model) | >WENV170658931 Pro CGG t ACCA tcttctcttc C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A C G A G + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGTC C - G T - A G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |