Sequence ID | >WENV170658941 |
Genome ID | JUGB01000738 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 949 |
End posion on genome | 1022 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cagtctccgc |
tRNA gene sequence |
GCGGGTATAGCACAATGGTAGTGCAGCAGCCTTCCAAGCTGAGGATGTCGGTTCGATCCC |
Downstream region at tRNA end position |
ggtttttaga |
Secondary structure (Cloverleaf model) | >WENV170658941 Gly TCC c TCCA ggtttttaga G - C C - G G - C G - C G - C T - A A - T C T T C T G C C A A A A | | | | G T C A C G G T C G G C G | | | | T T G G T G C T A A GGAT G A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |