Sequence ID | >WENV170658957 |
Genome ID | JUGB01001698 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 180 |
End posion on genome | 104 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acacttccgg |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
acacatcgaa |
Secondary structure (Cloverleaf model) | >WENV170658957 Met CAT g ACCA acacatcgaa T T G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |