Sequence ID | >WENV170658979 |
Genome ID | JUGB01005116 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 15 |
End posion on genome | 90 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
caccacccat |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCAACTGTCTTGTAAACAGTAGGTCATCCGTTCGATT |
Downstream region at tRNA end position |
tcttggatcc |
Secondary structure (Cloverleaf model) | >WENV170658979 Thr TGT t ACCA tcttggatcc G - C C - G C - G G - C C - G T - A T - A T T T T A G G C A T G A A | | | | | G T C T C G A T C C G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |