Sequence ID | >WENV170658980 |
Genome ID | JUGB01005161 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 274 |
End posion on genome | 201 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcagtacgtt |
tRNA gene sequence |
GGCCTCATGGCAGAGTGGCTATGCACCGGATTGCAAATCCGTTTACAGCGGTTCGATTCC |
Downstream region at tRNA end position |
attgaaaagc |
Secondary structure (Cloverleaf model) | >WENV170658980 Cys GCA t TCCA attgaaaagc G - C G - C C - G C - G T - A C - G A - T T T T T C G C C A G A G | | | | | G T G A C G A G C G G C G | | | T T G A T G C C T A TTAC C T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |