Sequence ID | >WENV170660023 |
Genome ID | JXWS01093521 |
Search identical group | |
Phylum/Class | [JXWS] soil metagenome; rice field; elevated CO2 |
Species | |
Start position on genome | 313 |
End posion on genome | 397 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttcgacgcga |
tRNA gene sequence |
GCCAGGATGGCCGAACGGTAAGGCGCACGCCTGGAAAGCGTGTTCCCTTTCGGGATTCTG |
Downstream region at tRNA end position |
tccgcgactg |
Secondary structure (Cloverleaf model) | >WENV170660023 Ser GGA a GCCT tccgcgactg G - C C - G C - G A - T G - C G - C A - T T A T G A C C C A A A G | | | | | A C G C C G C T G G G C G | | | T T G A G G C T A G TTCCCTTTCGGGATT C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |