Sequence ID | >VRL0100071 |
Genome ID | AJ890364 |
Search identical group | |
Phylum/Class | Phycodnaviridae |
Species | Emiliania huxleyi virus 86 |
Start position on genome | 43441 |
End posion on genome | 43367 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctatcgcagt |
tRNA gene sequence |
TCCCATGTAGCTCAATTGGTCAGAGCGTGCGGCTGTTAACCGCAAGGTTGTGTGTTCGAT |
Downstream region at tRNA end position |
cctcctatag |
Secondary structure (Cloverleaf model) | >VRL0100071 Asn GTT t GCgt cctcctatag T - A C - G C - G C - G A - T T + G G - C T T T C A C A C A T A A A | | | | | G T C T C G G T G T G C G | | | | T T G G A G C T C A G AGGTT T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |