Sequence ID | >VRL0100076 |
Genome ID | AY653733 |
Search identical group | |
Phylum/Class | Mimiviridae |
Species | Acanthamoeba polyphaga mimivirus |
Start position on genome | 352154 |
End posion on genome | 352224 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aatactataa |
tRNA gene sequence |
GATCCGTTAGTTTAGTGGTAGAACTACTGTTTGTGGGACGGTCGACACAGGTTCGATTCC |
Downstream region at tRNA end position |
ttgaaaattt |
Secondary structure (Cloverleaf model) | >VRL0100076 His GTG a Attt ttgaaaattt G - C A - T T + G C - G C - G G - C T - A T T T T G T C C A G A A | | | | | G T T T T G A C A G G C G + | | | T T G G A A C T A T CGAC A - T C - G T + G G - C T - A T G T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |