Sequence ID | >VRL0100102 |
Genome ID | DQ517337 |
Search identical group | |
Phylum/Class | Ascoviridae |
Species | Trichoplusia ni ascovirus 2c |
Start position on genome | 86653 |
End posion on genome | 86581 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aacaataaga |
tRNA gene sequence |
AGTCCGTTAGCTCAGTGGTTAGAGCATCGTGCTGATAACACGAGGGTCGTAGGTTCAAAT |
Downstream region at tRNA end position |
ttttgaaatg |
Secondary structure (Cloverleaf model) | >VRL0100102 Ile GAT a Atac ttttgaaatg A - T G - C T - A C - G C - G G + T T - A T A T C A T C C A T G A A | | | | | A G C T C G G T A G G C G | | | | T T T G A G C T A A GGGTC T - A C - G G - C T - A G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |