| Sequence ID | >WENV170665695 |
| Genome ID | JYMV01029428 |
| Phylum/Class | [JYMV] hydrothermal vent metagenome; Hydrothermal plumes at the Eastern Lau Spreading Center, Western Pacific Ocean |
| Species | |
|
Start position on genome
|
4163
|
|
End posion on genome
|
4236
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
TGT
|
|
Upstream region at tRNA start position
|
catttgctgg
|
|
tRNA gene sequence
|
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAGT CCCTTTGCCAGCTCnn
|
|
Downstream region at tRNA end position
|
nnnnnnnnnn
|
| Secondary structure (Cloverleaf model) | >WENV170665695 Thr TGT
g TCnn nnnnnnnnnn
G - C
C - G
T - A
G - C
G - C
C - G
G + T T G
T T T C C C A
T G A A + + | | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
T A A AGGTC
G - C
C - G
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |