Sequence ID | >WENV170667606 |
Genome ID | JYMV01049455 |
Search identical group | |
Phylum/Class | [JYMV] hydrothermal vent metagenome; Hydrothermal plumes at the Eastern Lau Spreading Center, Western Pacific Ocean |
Species | |
Start position on genome | 2549 |
End posion on genome | 2624 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttgttcgcT |
tRNA gene sequence |
GGGAGCGTGGTCTAGCTTGGTATGATTCTGCGTTTGGGACGCAGAGATCGCGCGTTCGAA |
Downstream region at tRNA end position |
ttttggtttt |
Secondary structure (Cloverleaf model) | >WENV170667606 Pro TGG T ATtt ttttggtttt G - C G - C G - C A - T G - C C - G G - C T A T C G C T C A C G A G | | | | G T T C T G G C G C G C T | | + T T G T G A T G T A T AGATC C - G T - A G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |