| Sequence ID | >WENV170667855 |
| Genome ID | JYMV01052232 |
| Phylum/Class | [JYMV] hydrothermal vent metagenome; Hydrothermal plumes at the Eastern Lau Spreading Center, Western Pacific Ocean |
| Species | |
|
Start position on genome
|
1732
|
|
End posion on genome
|
1808
|
|
Amino Acid
|
Pro
|
|
Anticodon
|
GGG
|
|
Upstream region at tRNA start position
|
ctctttcggt
|
|
tRNA gene sequence
|
CGGTGTGTAGCGCAGCCTGGTAGCGCACTGTCATGGGGTGTCAGGGGTCGGAGGTTCAAA TCCTCTCACACCGACCA
|
|
Downstream region at tRNA end position
|
acttctctct
|
| Secondary structure (Cloverleaf model) | >WENV170667855 Pro GGG
t ACCA acttctctct
C - G
G - C
G - C
T - A
G - C
T - A
G - C T A
T T C T C C A
C G A A + | | | | A
C C G C G G G A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
T - A
G - C
T T
C - G
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |