| Sequence ID | >WENV170668615 |
| Genome ID | LAHQ01005063 |
| Phylum/Class | [LAHQ] activated sludge metagenome; sample C-2; Sludge from acidogenic chamber (second chamber) of Anaerobic Baffled Reactor over |
| Species | |
| Start position on genome | 1517 |
| End posion on genome | 1443 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
agatctgcct |
| tRNA gene sequence |
GCCCAGGTAGCTCAGTGGGAGAGCGCTGCCCTGAAGAGGCAGTTGTCCCCGGTTCGAATC |
| Downstream region at tRNA end position |
aaaaaacagg |
| Secondary structure (Cloverleaf model) | >WENV170668615 Phe GAA
t ACCA aaaaaacagg
G - C
C - G
C - G
C - G
A - T
G - C
G + T T A
T G G G C C A
G A A | | | | | G
T C T C G C C C G G C
G | | | | T T
G G A G C
G A G TTGTC
C - G
T - A
G - C
C - G
C - G
C A
T G
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |