Sequence ID | >WENV170668684 |
Genome ID | LAHQ01014471 |
Search identical group | |
Phylum/Class | [LAHQ] activated sludge metagenome; sample C-2; Sludge from acidogenic chamber (second chamber) of Anaerobic Baffled Reactor over |
Species | |
Start position on genome | 414 |
End posion on genome | 491 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cctcccgggc |
tRNA gene sequence |
GGGACAGTAGGGTAGCCTGGTCCATCCTCGAGCGTTTGGGACGCTTGGACTGCGGTTCAA |
Downstream region at tRNA end position |
aatgcctttt |
Secondary structure (Cloverleaf model) | >WENV170668684 Pro TGG c ACCA aatgcctttt G - C G - C G - C A - T C - G A - T G - C T A T G C G C C A C C G A A + | | | | A T T G G G T G C G G C G | | + T T G T C C T T C C A C GGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |