Sequence ID | >WENV170670812 |
Genome ID | LAHU01001758 |
Search identical group | |
Phylum/Class | [LAHU] activated sludge metagenome; sample C-0; Zero hour mixed sludge faded in reactor as a methanogenic microbial inoculum from |
Species | |
Start position on genome | 79 |
End posion on genome | 5 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttgtttccct |
tRNA gene sequence |
GCCTCAGTAGCTCAGTTCGGGAGAGCGCCAGACTGAAGATCTGGTTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
ttnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170670812 Phe GAA t ACtt ttnnnnnnnn G - C C - G C - G T - A C - G A - T G - C T A T G G G C C A T G A A | | | | | A T C T C G C C C G G C C | | | | T T G G A G C G G A G TTGTC C - G C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |