Sequence ID | >PHG0300022 |
Genome ID | AJ604531 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Salmonella phage 5 K-12 (AJ604531) |
Start position on genome | 7948 |
End posion on genome | 7858 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttctaaatat |
tRNA gene sequence |
GTTGGATTAGTATCGTAGAGGTAGCGAAGCAGACTGTAAATCTGCCGACTCGGAAGGGTC |
Downstream region at tRNA end position |
aatttaagtc |
Secondary structure (Cloverleaf model) | >PHG0300022 Tyr GTA t ACCA aatttaagtc G - C T - A T - A G - C G - C A - T T - A T C T C T A C C A A T G C A | + | | | G G T A T G G G T G G C A + + T T G G C G A G T A A CGACTCGGAAGGGTCTCT G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |