Sequence ID | >WENV170672634 |
Genome ID | LAZR01000564 |
Search identical group | |
Phylum/Class | [LAZR] marine sediment metagenome; Loki non-amplified sample from Loki's castle hydrothermal vent sediment |
Species | |
Start position on genome | 714 |
End posion on genome | 803 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcagcactgt |
tRNA gene sequence |
GGAGGGATGGCTGAGTGGCTGAAGGCGCACGCCTGGAAAGTGTGTTTAGGTTTATCCCTA |
Downstream region at tRNA end position |
ttattcaata |
Secondary structure (Cloverleaf model) | >WENV170672634 Ser GGA t ACCA ttattcaata G - C G - C A - T G - C G - C G - C A - T T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G + | | T T C A G G C T G A G TTTAGGTTTATCCCTAAC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |