Sequence ID | >WENV170674732 |
Genome ID | LCWY01001066 |
Search identical group | |
Phylum/Class | [LCWY] anaerobic digester metagenome; anaerobic digester run at haloalkaline conditions (pH=10; 2.0M Na+) with Spirulina as substrate |
Species | |
Start position on genome | 2269 |
End posion on genome | 2194 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
agggtaccaa |
tRNA gene sequence |
GGGCGAATAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGAGA |
Downstream region at tRNA end position |
tttgcgggga |
Secondary structure (Cloverleaf model) | >WENV170674732 Val TAC a ACCA tttgcgggga G - C G - C G - C C - G G - C A - T A - T A G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |