Sequence ID | >WENV170675104 |
Genome ID | LCWZ01006247 |
Search identical group | |
Phylum/Class | [LCWZ] anaerobic digester metagenome; anaerobic digester run at haloalkaline conditions (pH=10; 2.0M Na+) with Spirulina as substrate |
Species | |
Start position on genome | 299 |
End posion on genome | 224 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctggttaaat |
tRNA gene sequence |
GGGCCATTAGCTCAGTTGGTAGAGCACCTGACTTTTAATCAGGTTGTCGGAGGTTCGATT |
Downstream region at tRNA end position |
tttattgacg |
Secondary structure (Cloverleaf model) | >WENV170675104 Lys TTT t ACCA tttattgacg G - C G + T G - C C - G C - G A - T T - A T T T C C T C C A T G A A | | | | | G T C T C G G G A G G C G | | | | T T G G A G C T A A TTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |