Sequence ID | >WENV170675755 |
Genome ID | LDZQ01000462 |
Search identical group | |
Phylum/Class | [LDZQ] terrestrial metagenome; oil reservoir sample I2 |
Species | |
Start position on genome | 292 |
End posion on genome | 368 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaataatggt |
tRNA gene sequence |
AGGCCAGTAGCTCAACTTGGCAGAGCATCGGACTCCAAATCCGAAGGTTGGGGGTTCAAG |
Downstream region at tRNA end position |
ttttttattt |
Secondary structure (Cloverleaf model) | >WENV170675755 Trp CCA t GCCA ttttttattt A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A C A A A | + | | | A T C T C G G G G G G C T | | | | T T G G A G C G C A A AGGTT T - A C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |