Sequence ID | >WENV170675859 |
Genome ID | LDZQ01001147 |
Search identical group | |
Phylum/Class | [LDZQ] terrestrial metagenome; oil reservoir sample I2 |
Species | |
Start position on genome | 76016 |
End posion on genome | 75931 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agagacaaga |
tRNA gene sequence |
GACGAGATAGCCAAGCCCGGTATGGCGCAGGATTGCTAATCCTGTGGGCGTTTCGCCCTC |
Downstream region at tRNA end position |
tatagcggtt |
Secondary structure (Cloverleaf model) | >WENV170675859 Ser GCT a GCtg tatagcggtt G - C A - T C - G G - C A - T G - C A - T T A T C C C C C A C G A A | | | | | A C A C C G G G G G G C C | | | | T T G T G G C G T A G TGGGCGTTTCGCCCTC C - G A - T G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |