Sequence ID | >WENV170675898 |
Genome ID | LDZQ01001195 |
Search identical group | |
Phylum/Class | [LDZQ] terrestrial metagenome; oil reservoir sample I2 |
Species | |
Start position on genome | 19799 |
End posion on genome | 19724 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agattctcaT |
tRNA gene sequence |
AGTCCCGTGGGGTAGTGGTAATCCTACCGGGCTTTGGACCCGGTGACAGCGGTTCGACTC |
Downstream region at tRNA end position |
tcctatatca |
Secondary structure (Cloverleaf model) | >WENV170675898 Gln TTG T ATCA tcctatatca A - T G - C T - A C - G C - G C - G G - C T C T T C G C C A T G A G | | | | | G G T G G G A G C G G C G | | + T T T T C C T A A A TGAC C - G C - G G - C G - C G - C C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |