Sequence ID | >WENV170676163 |
Genome ID | LDZR01001289 |
Search identical group | |
Phylum/Class | [LDZR] terrestrial metagenome; oil reservoir sample K2 |
Species | |
Start position on genome | 9016 |
End posion on genome | 8941 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttgtaccggc |
tRNA gene sequence |
GACCCGGTAGCTCAGCAGGCAGAGCACCTGACTTTTAATCAGGGGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
gtggtgcgag |
Secondary structure (Cloverleaf model) | >WENV170676163 Lys TTT c ACCA gtggtgcgag G - C A - T C - G C - G C - G G - C G - C T A T C A C C C A C G A A | | | | | G A C T C G G T G G G C G | | | | T T G G A G C C A A GGGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |