Sequence ID | >WENV170676171 |
Genome ID | LDZR01001290 |
Search identical group | |
Phylum/Class | [LDZR] terrestrial metagenome; oil reservoir sample K2 |
Species | |
Start position on genome | 6212 |
End posion on genome | 6287 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcgtaatcgc |
tRNA gene sequence |
AGGGCCGTAGCTCAACTGGTAGAGCGCCGGTCTCCAAAACCGGTGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
ttttttgatc |
Secondary structure (Cloverleaf model) | >WENV170676171 Trp CCA c GCCA ttttttgatc A - T G - C G - C G - C C - G C - G G - C T G T C G T C C A C A A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A G TGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |