Sequence ID | >WENV170677315 |
Genome ID | LDZT01004917 |
Search identical group | |
Phylum/Class | [LDZT] terrestrial metagenome; oil reservoir sample SB1 |
Species | |
Start position on genome | 13351 |
End posion on genome | 13275 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttaataataT |
tRNA gene sequence |
GGGCCCGTAGCCTAGCCAGGATAGGGCATCAGACTCCTAATCTGAGGGTCCCGGGTTCAA |
Downstream region at tRNA end position |
cttattctat |
Secondary structure (Cloverleaf model) | >WENV170677315 Arg CCT T GTta cttattctat G - C G - C G + T C - G C - G C - G G - C T A T G G C C C A C C G A A | | | | | A A T C C G C C G G G C G + | | | T T G G G G C A T A A GGGTC T - A C - G A - T G - C A - T C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |