Sequence ID | >WENV170677670 |
Genome ID | LDZT01008163 |
Search identical group | |
Phylum/Class | [LDZT] terrestrial metagenome; oil reservoir sample SB1 |
Species | |
Start position on genome | 4323 |
End posion on genome | 4250 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taatcccaaa |
tRNA gene sequence |
GCCTCAGTAGCTCAGACTGGGAGAGCGCCAGACTGAAGATCTGGTTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
atttctttta |
Secondary structure (Cloverleaf model) | >WENV170677670 Phe GAA a Atgg atttctttta G - C C - G C - G T + G C - G A - T G - C T A T G G G C C A A G A A | | | | | A C C T C G C C C G G C T | | | | T T G G A G C G G A G TTGTC C - G C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |