Sequence ID | >WENV170678653 |
Genome ID | LDZU01003547 |
Search identical group | |
Phylum/Class | [LDZU] terrestrial metagenome; oil reservoir sample SB2 |
Species | |
Start position on genome | 16301 |
End posion on genome | 16216 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atattctgaa |
tRNA gene sequence |
GCGGGGGTTGCCAAGCGGTCAAAGGCGCAGGGCTTAGGACCCTGTCCTGCAGAGGTTCGT |
Downstream region at tRNA end position |
ttttaccagt |
Secondary structure (Cloverleaf model) | >WENV170678653 Leu TAG a ACCA ttttaccagt G - C C - G G - C G - C G - C G - C G - C T A T T A C C C A C G A T + | | | | G G A C C G G T G G G C G | | | T T T A G G C C A A G TCCTGCAGAGGTTC C - G A - T G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |