Sequence ID | >WENV170678698 |
Genome ID | LDZU01003937 |
Search identical group | |
Phylum/Class | [LDZU] terrestrial metagenome; oil reservoir sample SB2 |
Species | |
Start position on genome | 5257 |
End posion on genome | 5330 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttcttgagac |
tRNA gene sequence |
GGGGCCATAGGGTAGCCTGGCCATCCTAGGAGACTGGGGGTCTTCTGACCTGCGTTCAAA |
Downstream region at tRNA end position |
cactactatt |
Secondary structure (Cloverleaf model) | >WENV170678698 Pro TGG c Attc cactactatt G - C G - C G - C G - C C - G C - G A - T T A T G A C G C A C G A A | | | | | A C T G G G C T G C G C T | + | | T T G A T C C G C C T CTGAC A - T G + T G - C A - T G G A G C G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |