Sequence ID | >WENV170678741 |
Genome ID | LDZU01004206 |
Search identical group | |
Phylum/Class | [LDZU] terrestrial metagenome; oil reservoir sample SB2 |
Species | |
Start position on genome | 59984 |
End posion on genome | 59911 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
atgagggggc |
tRNA gene sequence |
GCGATAATAGTCTAGTGGTAGGACAGGGGCTTCCCAAGCCTCTAGCCCGGGTTCGAATCC |
Downstream region at tRNA end position |
gaatggactc |
Secondary structure (Cloverleaf model) | >WENV170678741 Gly CCC c ATCA gaatggactc G - C C - G G - C A - T T - A A - T A - T T A T G G C C C A G A A | | | | | G T T C T G C C G G G C G + | | | T T G G G A C T A A TAGC G - C G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |