Sequence ID | >WENV170679059 |
Genome ID | LDZU01006864 |
Search identical group | |
Phylum/Class | [LDZU] terrestrial metagenome; oil reservoir sample SB2 |
Species | |
Start position on genome | 1272 |
End posion on genome | 1347 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgctcgagcc |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGAAGAGCACCGGACTTTTAATCCGGGTGTCACAGGTTCGATC |
Downstream region at tRNA end position |
tcggtatcat |
Secondary structure (Cloverleaf model) | >WENV170679059 Lys TTT c ACCA tcggtatcat G - C G - C G - C C - G C - G G - C T - A C T T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A A A GTGTC C - G C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |