Sequence ID | >WENV170679702 |
Genome ID | LFCJ01000161 |
Search identical group | |
Phylum/Class | [LFCJ] soda lake metagenome; sample B1-Br-g2; brine of Lake Bitter-1 |
Species | |
Start position on genome | 7388 |
End posion on genome | 7315 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aaggtgttga |
tRNA gene sequence |
GGGTTCGTGGGTTAGCTTGGCCATACTTCGGGCCTTGGGTGCCCGTGACCCCGGTTCGAA |
Downstream region at tRNA end position |
tcaattcatt |
Secondary structure (Cloverleaf model) | >WENV170679702 Pro TGG a Attt tcaattcatt G - C G - C G - C T - A T - A C - G G - C T A T G G G C C A T C G A G | | | | | G T T T G G C C C G G C G | | + T T G T A C T C C A T TGAC C - G G - C G - C G - C C - G C T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |