Sequence ID | >WENV170679834 |
Genome ID | LFCJ01000728 |
Search identical group | |
Phylum/Class | [LFCJ] soda lake metagenome; sample B1-Br-g2; brine of Lake Bitter-1 |
Species | |
Start position on genome | 14587 |
End posion on genome | 14673 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ctcccctgat |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGACCTTACGGTCGTG |
Downstream region at tRNA end position |
tctgattcac |
Secondary structure (Cloverleaf model) | >WENV170679834 Leu GAG t ACCA tctgattcac G - C C - G C - G G - C A - T A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGACCTTACGGTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |