Sequence ID | >WENV170679912 |
Genome ID | LFCJ01001411 |
Search identical group | |
Phylum/Class | [LFCJ] soda lake metagenome; sample B1-Br-g2; brine of Lake Bitter-1 |
Species | |
Start position on genome | 924 |
End posion on genome | 851 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
ccataggtga |
tRNA gene sequence |
GTCCTGGTAGGGTAGTGGACTATCCTCTTGGCTTGCGGAGCCAGGGACCGGAGTTCAAAT |
Downstream region at tRNA end position |
actcctcgcg |
Secondary structure (Cloverleaf model) | >WENV170679912 Arg GCG a GCtc actcctcgcg G - C T - A C - G C - G T - A G - C G + T T A T G C C T C A T G A A | | | | | A G T G G G C G G A G C G | | + T T A T C C T C T A C GGAC T + G T - A G - C G - C C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |