Sequence ID | >WENV170680412 |
Genome ID | LFCJ01010791 |
Search identical group | |
Phylum/Class | [LFCJ] soda lake metagenome; sample B1-Br-g2; brine of Lake Bitter-1 |
Species | |
Start position on genome | 2613 |
End posion on genome | 2689 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttttagtgaT |
tRNA gene sequence |
GGCCGAATAGCTCAGCCTGGGAGAGCGCTTCACTGAAGATGGAGTTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
aacaacattt |
Secondary structure (Cloverleaf model) | >WENV170680412 Phe GAA T AACt aacaacattt G - C G - C C - G C - G G - C A - T A - T T A T G G G C C A C G A A | | | | | A C C T C G C C C G G C T | | | | T T G G A G C G G A G TTGTC C - G T - A T + G C - G A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |