Sequence ID | >WENV170681050 |
Genome ID | LFFM01000004 |
Search identical group | |
Phylum/Class | [LFFM] soda lake metagenome; sample Tc-Br; brine of Tanatar trona crystallizer |
Species | |
Start position on genome | 68328 |
End posion on genome | 68400 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agtacaacaT |
tRNA gene sequence |
GGGGCCGTGGGGTAGTGGTATCCTCGCTGCCTTGGGTGCAGTGGACCTGAGTTCGACTCT |
Downstream region at tRNA end position |
tactattctt |
Secondary structure (Cloverleaf model) | >WENV170681050 Pro TGG T ATat tactattctt G - C G - C G - C G - C C - G C - G G - C T C T G A C T C A G A G | | | | | G T T G G G C T G A G C G | | + T T G T C C T T A C GGAC G + T C - G T - A G - C C - G C T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |