Sequence ID | >WENV170682091 |
Genome ID | LFFM01005979 |
Search identical group | |
Phylum/Class | [LFFM] soda lake metagenome; sample Tc-Br; brine of Tanatar trona crystallizer |
Species | |
Start position on genome | 6772 |
End posion on genome | 6698 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tttttatccg |
tRNA gene sequence |
GCGGTCATAGTGTAGTCCGGCCAATCATCTCGGCCTTTCGAGCCGAAGACCCGGGTTCAA |
Downstream region at tRNA end position |
gtcttcagaa |
Secondary structure (Cloverleaf model) | >WENV170682091 Glu TTC g Aaat gtcttcagaa G - C C - G G - C G - C T - A C - G A - T T A T G G C C C A C T G A A | | | | | A C T G T G C C G G G C G | | + T T G T C A T C C A A C AGAC T - A C - G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |