Sequence ID | >WENV170682690 |
Genome ID | LFIK01000929 |
Search identical group | |
Phylum/Class | [LFIK] soda lake metagenome; sample T5-Br; brine of Lake Tanatar-5 |
Species | |
Start position on genome | 10940 |
End posion on genome | 11014 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cacgaaacgg |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATTACCTTGCCAAGGTAAGGGTCGTGAGTTCGAATC |
Downstream region at tRNA end position |
tttcggaata |
Secondary structure (Cloverleaf model) | >WENV170682690 Gly GCC g TCCA tttcggaata G - C C - G G - C G - C G - C C - G G - C T A T T A C T C A G A A + | | | | G G C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC T - A T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |