| Sequence ID | >WENV170683416 |
| Genome ID | LFIK01011145 |
| Phylum/Class | [LFIK] soda lake metagenome; sample T5-Br; brine of Lake Tanatar-5 |
| Species | |
| Start position on genome | 4490 |
| End posion on genome | 4417 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
gagtgggtag |
| tRNA gene sequence |
GCGGGCATAGTTTAATGGTAGAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
gcatcttatg |
| Secondary structure (Cloverleaf model) | >WENV170683416 Gly TCC
g TCCA gcatcttatg
G - C
C - G
G - C
G - C
G - C
C - G
A - T T T
T C G C C C A
A A A | | | | | G
T T T T G G C G G G C
G + | | | T T
G G A A C
T A C TGAT
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |